Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0109188806:

Variant ID: vg0109188806 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 9188806
Reference Allele: AAlternative Allele: G,ACG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCGGTGTTTACCAAACCGTTTGATATGGGATTACCGCTCCGGTTTGGCGCATATAACGAGATATACCGTGGTTTCAAAAACATAAAGGTTACCGTAC[A/G,ACG]
TGATAACCACACACGGTTTGGTAAACCTGATCATCACACAATCGAGTGCAAATTAAAACCCTTTTGATATGGAGAACAACCTTCTTCACTATGGCAATTC

Reverse complement sequence

GAATTGCCATAGTGAAGAAGGTTGTTCTCCATATCAAAAGGGTTTTAATTTGCACTCGATTGTGTGATGATCAGGTTTACCAAACCGTGTGTGGTTATCA[T/C,CGT]
GTACGGTAACCTTTATGTTTTTGAAACCACGGTATATCTCGTTATATGCGCCAAACCGGAGCGGTAATCCCATATCAAACGGTTTGGTAAACACCGATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 43.70% 0.15% 0.32% NA
All Indica  2759 81.90% 17.60% 0.11% 0.40% NA
All Japonica  1512 4.90% 94.90% 0.07% 0.13% NA
Aus  269 98.50% 1.10% 0.00% 0.37% NA
Indica I  595 74.60% 24.90% 0.17% 0.34% NA
Indica II  465 52.50% 47.10% 0.00% 0.43% NA
Indica III  913 98.50% 1.20% 0.11% 0.22% NA
Indica Intermediate  786 85.50% 13.70% 0.13% 0.64% NA
Temperate Japonica  767 3.70% 96.20% 0.13% 0.00% NA
Tropical Japonica  504 6.30% 93.30% 0.00% 0.40% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 93.80% 1.04% 0.00% NA
Intermediate  90 38.90% 57.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0109188806 A -> G LOC_Os01g16230.1 upstream_gene_variant ; 3443.0bp to feature; MODIFIER silent_mutation Average:68.137; most accessible tissue: Minghui63 root, score: 97.054 N N N N
vg0109188806 A -> G LOC_Os01g16220-LOC_Os01g16230 intergenic_region ; MODIFIER silent_mutation Average:68.137; most accessible tissue: Minghui63 root, score: 97.054 N N N N
vg0109188806 A -> ACG LOC_Os01g16230.1 upstream_gene_variant ; 3442.0bp to feature; MODIFIER N Average:68.137; most accessible tissue: Minghui63 root, score: 97.054 N N N N
vg0109188806 A -> ACG LOC_Os01g16220-LOC_Os01g16230 intergenic_region ; MODIFIER N Average:68.137; most accessible tissue: Minghui63 root, score: 97.054 N N N N
vg0109188806 A -> DEL N N silent_mutation Average:68.137; most accessible tissue: Minghui63 root, score: 97.054 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0109188806 A ACG 0.57 0.09 0.08 0.09 0.12 0.1
vg0109188806 A G 0.0 0.0 0.0 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0109188806 6.22E-07 NA mr1862 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0109188806 NA 1.65E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251