\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107385646:

Variant ID: vg0107385646 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7385646
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACAAATTTCTGCTAAATACTCTATTAACCTTTTCTGTGTTATACTCATGCGTATGTATGCATTGATTGCTAAACATTTTCACATGTGCATTTGACAGCT[T/C]
AGGTGTGACTTGCAGCAAACAAGAATCTTTCTCCATTAGAAGGGATCAAACCGATCGAGAAGGATCAAATCAAGAAGAGAAAGGATCCTACCTAGTATCT

Reverse complement sequence

AGATACTAGGTAGGATCCTTTCTCTTCTTGATTTGATCCTTCTCGATCGGTTTGATCCCTTCTAATGGAGAAAGATTCTTGTTTGCTGCAAGTCACACCT[A/G]
AGCTGTCAAATGCACATGTGAAAATGTTTAGCAATCAATGCATACATACGCATGAGTATAACACAGAAAAGGTTAATAGAGTATTTAGCAGAAATTTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.20% 12.00% 0.19% 54.57% NA
All Indica  2759 2.30% 7.20% 0.25% 90.21% NA
All Japonica  1512 91.30% 5.50% 0.00% 3.17% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 4.40% 2.50% 0.34% 92.77% NA
Indica II  465 1.70% 9.70% 0.43% 88.17% NA
Indica III  913 1.40% 8.30% 0.11% 90.14% NA
Indica Intermediate  786 2.20% 8.00% 0.25% 89.57% NA
Temperate Japonica  767 97.70% 0.00% 0.00% 2.35% NA
Tropical Japonica  504 79.00% 16.10% 0.00% 4.96% NA
Japonica Intermediate  241 97.10% 0.80% 0.00% 2.07% NA
VI/Aromatic  96 89.60% 7.30% 0.00% 3.12% NA
Intermediate  90 41.10% 13.30% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107385646 T -> DEL N N silent_mutation Average:22.796; most accessible tissue: Callus, score: 50.996 N N N N
vg0107385646 T -> C LOC_Os01g13250.1 upstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:22.796; most accessible tissue: Callus, score: 50.996 N N N N
vg0107385646 T -> C LOC_Os01g13260.1 downstream_gene_variant ; 3696.0bp to feature; MODIFIER silent_mutation Average:22.796; most accessible tissue: Callus, score: 50.996 N N N N
vg0107385646 T -> C LOC_Os01g13229-LOC_Os01g13250 intergenic_region ; MODIFIER silent_mutation Average:22.796; most accessible tissue: Callus, score: 50.996 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107385646 NA 2.61E-16 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 6.57E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 3.71E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 1.21E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 7.51E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 4.28E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 3.98E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 3.25E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 7.48E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 9.69E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 3.07E-06 NA mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 1.03E-21 mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 4.48E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 5.71E-12 mr1649 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 4.89E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 1.23E-12 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 4.53E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 7.26E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 8.53E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107385646 NA 5.10E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251