\
| Variant ID: vg0102009968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2009968 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 34. )
TGCCTCCGTCGCCGCTGACTGGTGTCCTTGCCTATACGATTGGTTGGTCACACTACCGTTCATGGGCATCCACGTCTTCACCGACCGGCTGGCCTTTGCC[G/A]
CCGCTGACTGGTGTTTTCGCCTGCACGGCTGGCCTATTATGCCGCCGCTGTTGGGCGTCTACGACTTCACCGCCGGCCTGCCTCCGTCGCCGCCGACTGG
CCAGTCGGCGGCGACGGAGGCAGGCCGGCGGTGAAGTCGTAGACGCCCAACAGCGGCGGCATAATAGGCCAGCCGTGCAGGCGAAAACACCAGTCAGCGG[C/T]
GGCAAAGGCCAGCCGGTCGGTGAAGACGTGGATGCCCATGAACGGTAGTGTGACCAACCAATCGTATAGGCAAGGACACCAGTCAGCGGCGACGGAGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.70% | 14.60% | 32.73% | 23.00% | NA |
| All Indica | 2759 | 10.50% | 23.50% | 45.99% | 19.97% | NA |
| All Japonica | 1512 | 53.40% | 0.50% | 11.51% | 34.52% | NA |
| Aus | 269 | 74.70% | 7.40% | 17.47% | 0.37% | NA |
| Indica I | 595 | 5.70% | 6.90% | 53.78% | 33.61% | NA |
| Indica II | 465 | 25.80% | 25.60% | 34.19% | 14.41% | NA |
| Indica III | 913 | 6.70% | 27.10% | 50.82% | 15.44% | NA |
| Indica Intermediate | 786 | 9.70% | 30.70% | 41.48% | 18.19% | NA |
| Temperate Japonica | 767 | 65.60% | 0.70% | 8.60% | 25.16% | NA |
| Tropical Japonica | 504 | 38.90% | 0.60% | 14.68% | 45.83% | NA |
| Japonica Intermediate | 241 | 45.20% | 0.00% | 14.11% | 40.66% | NA |
| VI/Aromatic | 96 | 70.80% | 2.10% | 26.04% | 1.04% | NA |
| Intermediate | 90 | 40.00% | 11.10% | 35.56% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102009968 | G -> A | LOC_Os01g04510.1 | upstream_gene_variant ; 2714.0bp to feature; MODIFIER | silent_mutation | Average:21.527; most accessible tissue: Callus, score: 31.728 | N | N | N | N |
| vg0102009968 | G -> A | LOC_Os01g04520.1 | upstream_gene_variant ; 4853.0bp to feature; MODIFIER | silent_mutation | Average:21.527; most accessible tissue: Callus, score: 31.728 | N | N | N | N |
| vg0102009968 | G -> A | LOC_Os01g04510-LOC_Os01g04520 | intergenic_region ; MODIFIER | silent_mutation | Average:21.527; most accessible tissue: Callus, score: 31.728 | N | N | N | N |
| vg0102009968 | G -> DEL | N | N | silent_mutation | Average:21.527; most accessible tissue: Callus, score: 31.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102009968 | NA | 6.34E-07 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102009968 | NA | 8.67E-06 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102009968 | NA | 2.78E-06 | mr1680 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102009968 | NA | 6.97E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102009968 | 2.80E-06 | NA | mr1847 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102009968 | NA | 1.76E-06 | mr1341_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |