Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1019396664:

Variant ID: vg1019396664 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 19396664
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTAATGTAAAGTACTGTTTCATATGTATTAACTTGGATAAACGTGCCAGCAAAAGCACAATGCCAGAATGGGAACCAAAATGACCCAGTATGACATGGT[A/C]
TCTTTCTGTAAGACATCCTTAAACCTTGTGTTTTGTTGAACTTTATCATTTGCACCGAACCTTTTACAAGCATGTCTAATCACATGTGATGCTAGAGATT

Reverse complement sequence

AATCTCTAGCATCACATGTGATTAGACATGCTTGTAAAAGGTTCGGTGCAAATGATAAAGTTCAACAAAACACAAGGTTTAAGGATGTCTTACAGAAAGA[T/G]
ACCATGTCATACTGGGTCATTTTGGTTCCCATTCTGGCATTGTGCTTTTGCTGGCACGTTTATCCAAGTTAATACATATGAAACAGTACTTTACATTACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.20%	25.10%	0.28%	29.39%	NA
All Indica	2759	63.40%	1.40%	0.36%	34.83%	NA
All Japonica	1512	22.40%	72.40%	0.07%	5.16%	NA
Aus	269	5.60%	0.70%	0.37%	93.31%	NA
Indica I	595	93.80%	1.80%	0.00%	4.37%	NA
Indica II	465	58.70%	1.10%	0.65%	39.57%	NA
Indica III	913	48.10%	1.00%	0.44%	50.49%	NA
Indica Intermediate	786	60.80%	1.90%	0.38%	36.90%	NA
Temperate Japonica	767	2.90%	94.90%	0.13%	2.09%	NA
Tropical Japonica	504	57.90%	32.30%	0.00%	9.72%	NA
Japonica Intermediate	241	10.00%	84.60%	0.00%	5.39%	NA
VI/Aromatic	96	4.20%	28.10%	0.00%	67.71%	NA
Intermediate	90	35.60%	25.60%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1019396664	A -> C	LOC_Os10g36270.1	3_prime_UTR_variant ; 264.0bp to feature; MODIFIER	silent_mutation	Average:26.31; most accessible tissue: Callus, score: 67.156	N	N	N	N
vg1019396664	A -> C	LOC_Os10g36280.1	upstream_gene_variant ; 2208.0bp to feature; MODIFIER	silent_mutation	Average:26.31; most accessible tissue: Callus, score: 67.156	N	N	N	N
vg1019396664	A -> DEL	N	N	silent_mutation	Average:26.31; most accessible tissue: Callus, score: 67.156	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1019396664	NA	5.09E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	2.71E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	8.49E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	2.03E-16	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	3.75E-13	mr1784	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	1.33E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	6.96E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	9.34E-07	8.61E-06	mr1152_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	1.14E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	1.42E-06	NA	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	7.35E-13	mr1771_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	2.28E-13	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	6.48E-10	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	1.15E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	1.79E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	1.12E-12	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1019396664	NA	3.02E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251