Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0800488569:

Variant ID: vg0800488569 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 488569
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGTGGGTCAAGTAGCGACATTCCTTATAAATATCGATATATTTAGAAATACGGTAATTACCATATCATAAGAAACAAAAATTTCCACAAAATATGGTA[A/T]
ATACAGAAACGATCGGTATAATAACAAAACCATTTCCGTTTCCATTTCCATATTTTTACCATATCCATTTTTTTGTCGACTACTATTTCTATATGGCTCG

Reverse complement sequence

CGAGCCATATAGAAATAGTAGTCGACAAAAAAATGGATATGGTAAAAATATGGAAATGGAAACGGAAATGGTTTTGTTATTATACCGATCGTTTCTGTAT[T/A]
TACCATATTTTGTGGAAATTTTTGTTTCTTATGATATGGTAATTACCGTATTTCTAAATATATCGATATTTATAAGGAATGTCGCTACTTGACCCACAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 41.20% 0.06% 0.00% NA
All Indica  2759 88.40% 11.50% 0.07% 0.00% NA
All Japonica  1512 2.60% 97.40% 0.00% 0.00% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 78.70% 21.30% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 90.40% 9.40% 0.22% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0800488569 A -> T LOC_Os08g01810.1 downstream_gene_variant ; 1479.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0800488569 A -> T LOC_Os08g01794-LOC_Os08g01810 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0800488569 NA 2.10E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 3.12E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 5.09E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 2.53E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 8.42E-07 mr1092_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 2.03E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 9.16E-15 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 4.95E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 3.20E-07 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 1.00E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 4.54E-08 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 3.41E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 1.73E-06 mr1252_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 8.63E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0800488569 NA 4.13E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251