Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716989182:

Variant ID: vg0716989182 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16989182
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTATTTCTGTATGGACTAAAATATCCATACCAATCCTCTTACCATAGTCCCAAATCCCCAATCCCAGCAACCTGACGACGAGTATGGTATGGTGGACC[G/A]
CCGAGTAGCAGCGCAGATGATAGGGTTCGACGGCAGAGACGGAGGGTCCAACAGTGACGCATGGCCTGGCGATGGCGCCAATGGCGGAGAAAGCAGCGAC

Reverse complement sequence

GTCGCTGCTTTCTCCGCCATTGGCGCCATCGCCAGGCCATGCGTCACTGTTGGACCCTCCGTCTCTGCCGTCGAACCCTATCATCTGCGCTGCTACTCGG[C/T]
GGTCCACCATACCATACTCGTCGTCAGGTTGCTGGGATTGGGGATTTGGGACTATGGTAAGAGGATTGGTATGGATATTTTAGTCCATACAGAAATACAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 34.50% 0.04% 0.00% NA
All Indica  2759 96.40% 3.60% 0.00% 0.00% NA
All Japonica  1512 9.10% 90.90% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 91.10% 8.90% 0.00% 0.00% NA
Temperate Japonica  767 14.70% 85.30% 0.00% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 47.80% 50.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716989182 G -> A LOC_Os07g28940.1 downstream_gene_variant ; 4109.0bp to feature; MODIFIER silent_mutation Average:66.159; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N
vg0716989182 G -> A LOC_Os07g28960.1 downstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:66.159; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N
vg0716989182 G -> A LOC_Os07g28940-LOC_Os07g28960 intergenic_region ; MODIFIER silent_mutation Average:66.159; most accessible tissue: Zhenshan97 young leaf, score: 86.852 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716989182 NA 3.23E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 1.95E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 3.24E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 3.30E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 6.83E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 2.55E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 1.48E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 6.27E-07 6.27E-07 mr1514_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 3.64E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 5.91E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 2.46E-12 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716989182 NA 2.79E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251