Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0620193667:

Variant ID: vg0620193667 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 20193667
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GAGATGGATACCTTTGAAAATAGAAATACTACATAATGATATACCGTTGCAATGGAATAGCTGATGTGATATCTGATCTAATACCTACAAGGCATCATAT[C/A]
TGGTCTTAGAAATACCATGACGATGTTAGCATAGAACCTAGATACCAGATCTGATACCTACAGGGTATCATGTCTGGTATCAAAGGTACCTGATCTGATA

Reverse complement sequence

TATCAGATCAGGTACCTTTGATACCAGACATGATACCCTGTAGGTATCAGATCTGGTATCTAGGTTCTATGCTAACATCGTCATGGTATTTCTAAGACCA[G/T]
ATATGATGCCTTGTAGGTATTAGATCAGATATCACATCAGCTATTCCATTGCAACGGTATATCATTATGTAGTATTTCTATTTTCAAAGGTATCCATCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	10.20%	0.00%	0.00%	NA
All Indica	2759	97.30%	2.70%	0.00%	0.00%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	2.20%	97.80%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	94.10%	5.90%	0.00%	0.00%	NA
Temperate Japonica	767	95.30%	4.70%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	87.10%	12.90%	0.00%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0620193667	C -> A	LOC_Os06g34750.1	downstream_gene_variant ; 1889.0bp to feature; MODIFIER	silent_mutation	Average:70.789; most accessible tissue: Minghui63 young leaf, score: 85.633	N	N	N	N
vg0620193667	C -> A	LOC_Os06g34730-LOC_Os06g34750	intergenic_region ; MODIFIER	silent_mutation	Average:70.789; most accessible tissue: Minghui63 young leaf, score: 85.633	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0620193667	9.70E-07	NA	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0620193667	NA	9.28E-09	Grain_weight	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0620193667	NA	8.49E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.75E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.71E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.71E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	3.82E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	7.25E-06	mr1006_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	9.23E-07	3.16E-07	mr1037_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	4.08E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.44E-08	mr1126_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	2.03E-11	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	7.83E-22	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.48E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	4.26E-09	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.59E-07	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	3.63E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	1.08E-14	mr1911_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0620193667	NA	3.04E-07	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251