Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0430949013:

Variant ID: vg0430949013 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 30949013
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAGGCCGGCCACGGCCAGCTTCACGGCCACGACGCTGAGCGTGGCGCCCAGGGGCGGATCCAGCATAGGCTGGCGGGATCTCAAGCCTCTACTACTAA[C/T]
ATGAACGTGAAAACTATGAGAGCCCCACGAAAATTGCACTGAATTTTTTACCTTATATAGATGAGAGGGGGACTGTAACTCTATATAATTTGCTCAGACA

Reverse complement sequence

TGTCTGAGCAAATTATATAGAGTTACAGTCCCCCTCTCATCTATATAAGGTAAAAAATTCAGTGCAATTTTCGTGGGGCTCTCATAGTTTTCACGTTCAT[G/A]
TTAGTAGTAGAGGCTTGAGATCCCGCCAGCCTATGCTGGATCCGCCCCTGGGCGCCACGCTCAGCGTCGTGGCCGTGAAGCTGGCCGTGGCCGGCCTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 48.70% 2.54% 0.00% NA
All Indica  2759 27.90% 71.90% 0.18% 0.00% NA
All Japonica  1512 80.00% 12.80% 7.28% 0.00% NA
Aus  269 84.00% 15.60% 0.37% 0.00% NA
Indica I  595 12.80% 86.70% 0.50% 0.00% NA
Indica II  465 10.10% 89.90% 0.00% 0.00% NA
Indica III  913 46.10% 53.80% 0.11% 0.00% NA
Indica Intermediate  786 28.80% 71.10% 0.13% 0.00% NA
Temperate Japonica  767 66.00% 20.30% 13.69% 0.00% NA
Tropical Japonica  504 97.00% 2.60% 0.40% 0.00% NA
Japonica Intermediate  241 88.80% 10.00% 1.24% 0.00% NA
VI/Aromatic  96 55.20% 42.70% 2.08% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0430949013 C -> T LOC_Os04g52100.1 upstream_gene_variant ; 322.0bp to feature; MODIFIER silent_mutation Average:98.629; most accessible tissue: Callus, score: 99.227 N N N N
vg0430949013 C -> T LOC_Os04g52110.1 upstream_gene_variant ; 1926.0bp to feature; MODIFIER silent_mutation Average:98.629; most accessible tissue: Callus, score: 99.227 N N N N
vg0430949013 C -> T LOC_Os04g52120.1 downstream_gene_variant ; 3485.0bp to feature; MODIFIER silent_mutation Average:98.629; most accessible tissue: Callus, score: 99.227 N N N N
vg0430949013 C -> T LOC_Os04g52100-LOC_Os04g52110 intergenic_region ; MODIFIER silent_mutation Average:98.629; most accessible tissue: Callus, score: 99.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0430949013 C T -0.03 -0.02 -0.02 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0430949013 NA 1.13E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 4.90E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 5.65E-08 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 5.06E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 1.85E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 1.35E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 2.68E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 8.01E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 1.77E-06 mr1049_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 1.84E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 2.90E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 6.79E-07 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 3.89E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 1.13E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 8.86E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 NA 7.16E-11 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 1.46E-06 1.46E-06 mr1914_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 3.29E-06 3.29E-06 mr1927_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430949013 3.25E-06 3.25E-06 mr1981_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251