Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0307871179:

Variant ID: vg0307871179 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 7871179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGCGAGACAAATGAAGCACGAGTTGATGTGCAAACCTTTCCCTCCTTCCAGAATCCCATAACTTCTTCTCTGAGGCTGTGTTTAATTCAGCGTAAAGTTT[G/A]
GATTTTTATTAAAATTAAAGATGATGTGACTGAAAAATTATATGTGTATGACAGTTTGATGTGATAAAAAAGGACTGAAATTTAGATCTAAACTTTGGAT

Reverse complement sequence

ATCCAAAGTTTAGATCTAAATTTCAGTCCTTTTTTATCACATCAAACTGTCATACACATATAATTTTTCAGTCACATCATCTTTAATTTTAATAAAAATC[C/T]
AAACTTTACGCTGAATTAAACACAGCCTCAGAGAAGAAGTTATGGGATTCTGGAAGGAGGGAAAGGTTTGCACATCAACTCGTGCTTCATTTGTCTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.50% 0.08% 0.00% NA
All Indica  2759 88.70% 11.30% 0.04% 0.00% NA
All Japonica  1512 98.70% 1.10% 0.13% 0.00% NA
Aus  269 6.70% 93.30% 0.00% 0.00% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 86.40% 13.50% 0.11% 0.00% NA
Indica Intermediate  786 83.30% 16.70% 0.00% 0.00% NA
Temperate Japonica  767 98.60% 1.30% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 87.50% 1.04% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0307871179 G -> A LOC_Os03g14500.1 upstream_gene_variant ; 315.0bp to feature; MODIFIER silent_mutation Average:90.723; most accessible tissue: Zhenshan97 young leaf, score: 96.575 N N N N
vg0307871179 G -> A LOC_Os03g14510.1 upstream_gene_variant ; 3358.0bp to feature; MODIFIER silent_mutation Average:90.723; most accessible tissue: Zhenshan97 young leaf, score: 96.575 N N N N
vg0307871179 G -> A LOC_Os03g14510.2 upstream_gene_variant ; 3358.0bp to feature; MODIFIER silent_mutation Average:90.723; most accessible tissue: Zhenshan97 young leaf, score: 96.575 N N N N
vg0307871179 G -> A LOC_Os03g14490.1 downstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:90.723; most accessible tissue: Zhenshan97 young leaf, score: 96.575 N N N N
vg0307871179 G -> A LOC_Os03g14490-LOC_Os03g14500 intergenic_region ; MODIFIER silent_mutation Average:90.723; most accessible tissue: Zhenshan97 young leaf, score: 96.575 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0307871179 G A 0.0 0.0 -0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0307871179 NA 3.29E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 1.54E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 1.23E-17 mr1522 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 2.07E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 2.42E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 2.63E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 1.61E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 1.27E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 2.51E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 4.03E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 4.28E-09 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 2.57E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0307871179 NA 4.71E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251