Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205810722:

Variant ID: vg0205810722 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5810722
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAACTGTATTCCCTGTTCAATAATCGATGAGTGATTCAAAAACCTGGCTAACAGTGCATTTGCATTCTTTTGCAGTGAAAAACAACCAGATGTCCCAGT[A/C]
AAAAAAAAAAAAAAAAAACCAGATGTGCCAATGTGCAATCTCTTCTCAGCCACAGAGAATAAAATGGAGAAACGCCAACATATATGCTGTGGGCAGGATC

Reverse complement sequence

GATCCTGCCCACAGCATATATGTTGGCGTTTCTCCATTTTATTCTCTGTGGCTGAGAAGAGATTGCACATTGGCACATCTGGTTTTTTTTTTTTTTTTTT[T/G]
ACTGGGACATCTGGTTGTTTTTCACTGCAAAAGAATGCAAATGCACTGTTAGCCAGGTTTTTGAATCACTCATCGATTATTGAACAGGGAATACAGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	44.00%	8.68%	0.00%	NA
All Indica	2759	76.00%	13.00%	11.02%	0.00%	NA
All Japonica	1512	3.40%	90.80%	5.82%	0.00%	NA
Aus	269	11.90%	86.20%	1.86%	0.00%	NA
Indica I	595	83.00%	3.70%	13.28%	0.00%	NA
Indica II	465	72.50%	11.60%	15.91%	0.00%	NA
Indica III	913	75.10%	16.90%	8.00%	0.00%	NA
Indica Intermediate	786	73.80%	16.30%	9.92%	0.00%	NA
Temperate Japonica	767	3.10%	87.90%	9.00%	0.00%	NA
Tropical Japonica	504	3.00%	95.60%	1.39%	0.00%	NA
Japonica Intermediate	241	5.00%	90.00%	4.98%	0.00%	NA
VI/Aromatic	96	18.80%	67.70%	13.54%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205810722	A -> C	LOC_Os02g10920.4	upstream_gene_variant ; 4327.0bp to feature; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N
vg0205810722	A -> C	LOC_Os02g10920.5	upstream_gene_variant ; 4327.0bp to feature; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N
vg0205810722	A -> C	LOC_Os02g10920.6	upstream_gene_variant ; 4221.0bp to feature; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N
vg0205810722	A -> C	LOC_Os02g10930.1	downstream_gene_variant ; 3768.0bp to feature; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N
vg0205810722	A -> C	LOC_Os02g10940.1	downstream_gene_variant ; 1372.0bp to feature; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N
vg0205810722	A -> C	LOC_Os02g10930-LOC_Os02g10940	intergenic_region ; MODIFIER	silent_mutation	Average:67.599; most accessible tissue: Callus, score: 89.615	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205810722	NA	6.09E-20	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	6.43E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	2.76E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	5.02E-20	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	2.02E-06	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	3.23E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	2.76E-06	2.76E-06	mr1799_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	5.37E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205810722	NA	1.63E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251